Please use this identifier to cite or link to this item: https://hdl.handle.net/10356/145155
Title: Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Authors: Wang, Zi-Fu
Li, Ming-Hao
Chu, I-Te
Winnerdy, Fernaldo Richtia
Phan, Anh Tuân
Chang, Ta-Chau
Keywords: Science
Issue Date: 2020
Source: Wang, Z.-F., Li, M.-H., Chu, I.-T., Winnerdy, F. R., Phan, A. T., & Chang, T.-C. (2020). Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter. Nucleic Acids Research, 48(3), 1120-1130. doi:10.1093/nar/gkz1207
Journal: Nucleic Acids Research
Abstract: Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
URI: https://hdl.handle.net/10356/145155
ISSN: 0305-1048
DOI: 10.1093/nar/gkz1207
Rights: © 2020 The Author(s). Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
Fulltext Permission: open
Fulltext Availability: With Fulltext
Appears in Collections:SPMS Journal Articles

Files in This Item:
File Description SizeFormat 
gkz1207.pdf2 MBAdobe PDFView/Open

SCOPUSTM   
Citations 50

2
Updated on Mar 10, 2021

PublonsTM
Citations 50

2
Updated on Mar 8, 2021

Page view(s)

8
Updated on Apr 16, 2021

Download(s) 50

33
Updated on Apr 16, 2021

Google ScholarTM

Check

Altmetric


Plumx

Items in DR-NTU are protected by copyright, with all rights reserved, unless otherwise indicated.