Please use this identifier to cite or link to this item:
https://hdl.handle.net/10356/145155
Title: | Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter | Authors: | Wang, Zi-Fu Li, Ming-Hao Chu, I-Te Winnerdy, Fernaldo Richtia Phan, Anh Tuân Chang, Ta-Chau |
Keywords: | Science | Issue Date: | 2020 | Source: | Wang, Z.-F., Li, M.-H., Chu, I.-T., Winnerdy, F. R., Phan, A. T., & Chang, T.-C. (2020). Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter. Nucleic Acids Research, 48(3), 1120-1130. doi:10.1093/nar/gkz1207 | Journal: | Nucleic Acids Research | Abstract: | Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification. | URI: | https://hdl.handle.net/10356/145155 | ISSN: | 0305-1048 | DOI: | 10.1093/nar/gkz1207 | Schools: | School of Physical and Mathematical Sciences | Research Centres: | NTU Institute of Structural Biology | Rights: | © 2020 The Author(s). Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. | Fulltext Permission: | open | Fulltext Availability: | With Fulltext |
Appears in Collections: | SPMS Journal Articles |
Files in This Item:
File | Description | Size | Format | |
---|---|---|---|---|
gkz1207.pdf | 2 MB | Adobe PDF | View/Open |
SCOPUSTM
Citations
20
9
Updated on Mar 26, 2024
Web of ScienceTM
Citations
20
6
Updated on Oct 24, 2023
Page view(s)
273
Updated on Mar 29, 2024
Download(s) 50
110
Updated on Mar 29, 2024
Google ScholarTM
Check
Altmetric
Items in DR-NTU are protected by copyright, with all rights reserved, unless otherwise indicated.